Molecular Detection of Hepcidin (HAMP) Gene in Selected Iron Deficiency Anemia Patients from Basrah Governorate, Iraq
Main Article Content
Abstract
Anemia constitutes one of the most common blood diseases, which can be dangerous and more complex than it appears. This danger comes from the apparent lack of iron which is a vital element in various metabolic and anabolic processes. The HAMP gene produces a protein called Hepcidin, which has a very important role in iron metabolism. This study aimed at the molecular detection of HAMP gene in selected iron deficiency anemia patients, as well as healthy control, from Basra community in the south of Iraq. Forty five samples were collected from private clinics, which were divided into 33 samples for affected patients and 12 samples represented the control group. A450 bp fragment containing HAMP exon 3was amplified using Forward: CCGTTCCCTGCTCACATTCC and Reverse: TTCACCAACTTTCCTGGCAAC . Eight different polymorphisms were obtained depending on the number of mutations that occurred for the gene compared to what was recorded in the GenBank for the same gene, 6 polymorphisms, studies represented the affected and 2 represented the control, they were all registered in the GenBank under accession numbers LC707242, LC707243, LC707244, LC707245, and LC707246 (patients’ samples), and LC707247, and LC707248,LC707249 (control samples). The polymorphisms obtained in the current study had a number of different mutations, whether silent or missense, some mutations occurred in more than one polymorphism, while some occurred in one polymorphism. It was noted that some mutations occurred in all polymorphisms of the study. When conducting a BLAST analysis, it was found that the results obtained were closer to each of the genes recorded in America and South Africa, and this can be clearly observed in the analysis of the phylogenetic tree. The results of the analysis of the three-dimensional structure of the expected protein indicated a great match between the polymorphisms of the study except for polymorphism LC707245. As a result of the occurrence of these mutations, the HAMP gene in Iraq has more than one polymorphism, these polymorphisms may be associated with the function of the gene. Therefore, further studies are needed to link this polymorphism to various traits associated with anemia.
Article Details
References
Abdelrhman, A. H., Abdelgadir, E. A., & Khalid, K. M. (2020). Molecular Study of Hepcidin HAMP (-582A/G) Gene Polymorphisms and Measurement of Serum Hepcidin Level among Sudanese Patients with Anemia of Chronic Kidney Disease. International Journal of Clinical Skills, 14(2), 318-323.
Boratyn, G. M., Thierry-Mieg, J., Thierry-Mieg, D., Busby, B., & Madden, T. L. (2019). Magic-BLAST, an accurate RNA-seq aligner for long and short reads. BMC bioinformatics, 20(1), 1-19.
Bouri, S., & Martin, J. (2018). Investigation of iron deficiency anaemia. Clinical Medicine, 18(3), 242.
Chaudhry, H. S., &Kasarla, M. R. (2017). Microcytic hypochromic anemia.
Elstrott, B., Khan, L., Olson, S., Raghunathan, V., DeLoughery, T., &Shatzel, J. J. (2020). The role of iron repletion in adult iron deficiency anemia and other diseases. European journal of haematology, 104(3), 153-161.
Ganz, T. (2006). Hepcidin and its role in regulating systemic iron metabolism. ASH Education Program Book, 2006(1), 29-35.
Ganz, T., Olbina, G., Girelli, D., Nemeth, E., &Westerman, M. (2008). Immunoassay for human serum hepcidin. Blood, The Journal of the American Society of Hematology, 112(10), 4292-4297.
Ganz, T. (2011). Hepcidin and iron regulation, 10 years later. Blood, The Journal of the American Society of Hematology, 117(17), 4425-4433.
Hicks, M., Bartha, I., di Iulio, J., Venter, J. C., &Telenti, A. (2019). Functional characterization of 3D protein structures informed by human genetic diversity. Proceedings of the National Academy of Sciences, 116(18), 8960-8965.
Jallow, M. W., Cerami, C., Clark, T. G., Prentice, A. M., &Campino, S. (2020). Differences in the frequency of genetic variants associated with iron imbalance among global populations. PloS one, 15(7), e0235141.
Kanwar, P., &Kowdley, K. V. (2013). Diagnosis and treatment of hereditary hemochromatosis: an update. Expert review of gastroenterology & hepatology, 7(6), 517-530.
Kemna, E. H., Tjalsma, H., Willems, J. L., & Swinkels, D. W. (2008). Hepcidin: from discovery to differential diagnosis.
Khayat, M. M., Hu, J., Jiang, Y., Li, H., Chander, V., Dawood, M., ... & Gibbs, R. A. (2021). AHDC1 missense mutations in Xia-Gibbs syndrome. Human Genetics and Genomics Advances, 2(4), 100049.
Komar, A.A. (2007). Silent SNPs: impact on gene function and phenotype. Pharmacogenomics, 8 (8): 1075–1080.
Malerba, M., Louis, S., Cuvellier, S., Shambat, S. M., Hua, C., Gomart, C., ... &Peyssonnaux, C. (2020). Epidermal hepcidin is required for neutrophil response to bacterial infection. The Journal of clinical investigation, 130(1), 329-334.
McGregor, N. W. (2009). Characterization of the promoter region of the HAMP gene implicated in iron metabolism and its possible association with Oesophageal Cancer in the Black South African population (Doctoral dissertation, Stellenbosch: University of Stellenbosch).
McLachlan, S., Page, K. E., Lee, S. M., Loguinov, A., Valore, E., Hui, S. T., ... &Vulpe, C. D. (2017). Hamp1 mRNA and plasma hepcidin levels are influenced by sex and strain but do not predict tissue iron levels in inbred mice. American Journal of Physiology-Gastrointestinal and Liver Physiology, 313(5), G511-G523.
Melis, M. A., Cau, M., Congiu, R., Sole, G., Barella, S., Cao, A., ... &Galanello, R. (2008). A mutation in the TMPRSS6 gene, encoding a transmembrane serine protease that suppresses hepcidin production, in familial iron deficiency anemia refractory to oral iron. haematologica, 93(10), 1473-1479.
Meyerson, W., Leisman, J., Navarro, F. C., & Gerstein, M. (2020). Origins and characterization of variants shared between databases of somatic and germline human mutations. BMC bioinformatics, 21(1), 1-22.
Mohajeri, A., & Ashrafi, A. (2011). Structure and electronic properties of amino acid ionic liquids. The Journal of Physical Chemistry A, 115(24), 6589-6593.
Ngole, M., Race, V., Mbayabo, G., Lumbala, P., Songo, C., Lukusa, P. T., ... &Lumaka, A. (2022). DNA testing for sickle cell anemia in Africa: Implementation choices for the Democratic Republic of Congo. Journal of Clinical Laboratory Analysis, 36(5), e24398.
Pandey, S., Pandey, S. K., & Shah, V. (2018). Role of HAMP genetic variants on pathophysiology of iron deficiency anemia. Indian Journal of Clinical Biochemistry, 33(4), 479-482.
Parajes, S., González-Quintela, A., Campos, J., Quinteiro, C., Domínguez, F., &Loidi, L. (2010). Genetic study of the hepcidin gene (HAMP) promoter and functional analysis of the c.-582A> G variant. BMC genetics, 11(1), 1-7.
Peyton, M. A. (2021). The Silent Mutation. JAMA, 325(17), 1721-1722.
Portugal-Nunes, C., Castanho, T. C., Amorim, L., Moreira, P. S., Mariz, J., Marques, F., ... &Palha, J. A. (2020). Iron status is associated with mood, cognition, and functional ability in older adults: A cross-sectional study. Nutrients, 12(11), 3594.
Sun, T., Chen, Y., Wen, Y., Zhu, Z., & Li, M. (2021). Prempli: a machine learning model for predicting the effects of missense mutations on protein-ligand interactions. Communications biology, 4(1), 1-11.
Tamura, K., Stecher, G., & Kumar, S. (2021). MEGA11: molecular evolutionary genetics analysis version 11. Molecular biology and evolution, 38(7), 3022-3027.
Waterhouse, A., Bertoni, M., Bienert, S., Studer, G., Tauriello, G., Gumienny, R., ... &Schwede, T. (2018). SWISS-MODEL: homology modelling of protein structures and complexes. Nucleic acids research, 46(W1), W296-W303.
Xu, Y., Alfaro‐Magallanes, V. M., &Babitt, J. L. (2021). Physiological and pathophysiological mechanisms of hepcidin regulation: clinical implications for iron disorders. British Journal of Haematology, 193(5), 882-893.
Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., & Madden, T. L. (2012). Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC bioinformatics, 13(1), 1-11.
Zhang, Z., Miteva, M. A., Wang, L., &Alexov, E. (2012). Analyzing effects of naturally occurring missense mutations. Computational and mathematical methods in medicine, 2012.
Zhang, Y., Wen, J., &Yau, S. S. T. (2019). Phylogenetic analysis of protein sequences based on a novel k-mer natural vector method. Genomics, 111(6), 1298-1305.